EST details — SGN-E248982

Search information 
Request: 248982Match: SGN-E248982
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C28720Clone name: cLEF-49-A13
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C176945 is on microarray TOM1: SGN-S1-1-2.1.8.2
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176945 [TUS-25-E7] Trace: SGN-T181656 EST: SGN-E369794 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E248982Length: 314 bp (851 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E248982 [] (trimmed) TGATATTTGTTTGCTAGAAAAATGAAGATGAAGAAGGCGACTATGATTGCTACAGTGACGGATGGCCTTCCATTAGCTGAGGGGCTGGATGATAT
CCATGATGTGCCAAATACAAATTACTACAAACAGCAAGTGAAGACCTTATTCAAGAATCTTTCTATGGGCCATAATGAAGCATCAAGGATGTCCA
TTGAAAGTGGACCTTACATTTTCCACTATATAATAGAAGGGCGCGTTTGCTATCTGACAATGTGTGATCGCTCTTATCCAAAGAAACTTGCCTTT
CAGTACCTAGAAGACCTTAAGAATGAGTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E248982] SGN-U567543 Tomato 200607 Build 2 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T62490 [Download][View] Facility Assigned ID: TMGHK07TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0377 Quality Trim Threshold: 14.5