EST details — SGN-E249065

Search information 
Request: 249065Match: SGN-E249065
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C28735Clone name: cLEF-49-B1
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C176954 is on microarray TOM1: SGN-S1-1-1.1.8.6
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176954 [TUS-25-E16] Trace: SGN-T181735 EST: SGN-E369243 Direction: 3' Facility: INRA
Clone: SGN-C176954 [TUS-25-E16] Trace: SGN-T181736 EST: SGN-E369244 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E249065Length: 392 bp (904 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E249065 [] (trimmed) GTTCCTCAGTAGCCGTCCCTTGCAGGTTGAAGGAGGAGAAGGATGTCTCACAGGAAGTTTGAGCACCCAAGACACGGTTCTTTGGGATTTCTCCC
CAGGAAGCGTGCTGCCAGACACAGGGGAAAGGTGAAGGCATTCCCAAAGGATGACCCAAGCAAGCCTTGCAAGCTAACTGCCTTCTTGGGTTACA
AGGCTGGAATGACTCACATTGTCAGAGAAGTTGAGAAACCTGGATCAAAACTCCACAAGAAAGAGACATGTGAAGCTGTTACCATTGTTGAAACA
CCTCCTATGGTGATTGTTGGTGTTGTTGGGTATGTGAAGACCCCTCGTGGTCTTCGTTGCCTGAACACAGTCTGGGCTCAACATCTCAGTGAAGA
CATTAAGAGGAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E249065] SGN-U579621 Tomato 200607 Build 2 202 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T62573 [Download][View] Facility Assigned ID: TMGHM01TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.953 Expected Error Rate: 0.0032 Quality Trim Threshold: 14.5