EST details — SGN-E249958

Search information 
Request: 249958Match: SGN-E249958
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C39422Clone name: cLEG-4-A14
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C180554 is on microarray TOM1: SGN-S1-1-1.3.19.10
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C180554 [TUS-34-K16] Trace: SGN-T197553 EST: SGN-E396227 Direction: 3' Facility: INRA
Clone: SGN-C180554 [TUS-34-K16] Trace: SGN-T199702 EST: SGN-E398376 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E249958Length: 544 bp (570 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E249958 [] (trimmed) CGGGCTGCAGGCGGAGCCAAAAAGCATCATATGATAGGAATATACATGCAGAGATCATGGATCGTTGTCACAATCTGTTGTATCCTTCTCCTTCC
CATGTACATATTCGCTACCCCTATTTTAAAAGCACTAGGTCAACCAAACGACGTCGCAGAGCTTTCAGGGGTGGTTGCGTTGTGGTTTATACCAC
TGCAATTCAGCTTTGCTTTTCAATTTACGATACAGAGGTTTCTACAGAGCCAGCTGAAGACGGCGGTAATCGCCTGGATTTCACTAGCGGTGCTG
GCGATTCACACGGCTATCAGTTGGTTGTTTGTGTACAAATTGAAATTGGGGATAGTGGGAGCCGCCGTAGCACTGGACATATCGTGGTGGTTGCT
GGTTGTTGGACTGTTTATATACGCCGCATGCGGTGGGTGCCCAGAAACGTGGAATGGTTTTTCTACACAAGCATTTTCGGGACTTTGGGAATTTT
TTCGACTCTCCGCTTCTGCTGGTGTCATGCTTTGCTTGGAGAATTGGTACTATAGGATACTGATATTGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E249958] SGN-U570359 Tomato 200607 Build 2 24 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T64572 [Download][View] Facility Assigned ID: TBFAN07TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.979 Expected Error Rate: 0.0051 Quality Trim Threshold: 20.5