EST details — SGN-E250794

Search information 
Request: 250794Match: SGN-E250794
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C31325Clone name: cLEG-13-A21
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C180515 is on microarray TOM1: SGN-S1-1-8.2.19.6
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C180515 [TUS-34-J1] Trace: SGN-T187076 EST: SGN-E375174 Direction: 3' Facility: INRA
Clone: SGN-C180515 [TUS-34-J1] Trace: SGN-T187077 EST: SGN-E375175 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E250794Length: 504 bp (873 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E250794 [] (trimmed) TTCACAATTTAACTATGAAGAAAGCGCAAACTAAATGTGGAAATCAAAACTACCTCACAATATGCCATACTCGTTTAAATAAAAATCGTGTTATA
AAGCAAAGCCAGTAACTAAAGGGCTCTACCAAAGGAAGTCGCAACATCTGGAAAACTCCAATATGAACATAGTGACACCACGTATTAGTCTCTAT
TGCTTTTTGCCTTTTAAGTGGACCTCTTGGAATTTTGCTAAGAACATTGGCGTCAAAAACAGCATAATGCTTCTTGATCTCTGCCTCTGCTTTCT
CAGCAACAGCATCAACCTTGTCCTCATGCTTCTCATAGAGCACAGGGACAGTATGCAGTAATACAAAAACTATGTAAAACAAGGTGAGGAAGTTC
CAGATATTCCCCAATATAGAAACAATCCACAAGCCAACAATGACAACAAGGAACTTCTTCAAGTCTTTCCCAGATGCAATATCCCGTAGGATCTC
AAGGGCCCTATTGATTTCAATCCTCAATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E250794] SGN-U584489 Tomato 200607 Build 2 34 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T66273 [Download][View] Facility Assigned ID: TBFBW11TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.956 Expected Error Rate: 0.0276 Quality Trim Threshold: 14.5