EST details — SGN-E253141

Search information 
Request: 253141Match: SGN-E253141
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C33270Clone name: cLEG-26-C1
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C180388 is on microarray TOM1: SGN-S1-1-7.4.19.12
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C180388 [TUS-34-D18] Trace: SGN-T187214 EST: SGN-E375446 Direction: 3' Facility: INRA
Clone: SGN-C180388 [TUS-34-D18] Trace: SGN-T187215 EST: SGN-E375447 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E253141Length: 511 bp (989 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E253141 [] (trimmed) GGGGGGGATGATGTATAGGTCCAGATTGAGATCCACGTAGTGGTTTAATGGTGATTTCCATATTGTATAACTTCCCTGGACCCATGACTTTAATT
CTCAACTACCAATTTAAACCACGCATATTCCACCCCTTTGGTCTCATATCCTTTATCAATATAAACACAATTTCAGCTCACAAAAATGGCGTTTT
CTTGAACAAATTTTCTGAATCTTCAAATCATACTTGGTCACCAATTATGACAACAGATACAACAACTCTGAGTTATTGGCTGAACTGGAGATTCT
TAATATGTTCAATATTGATATTAGCAGCTATGGTGGTATCACTTCTCCTTATATGGAAGTACGATTGTTCTTCAAAGTACCGAAAAGAAAATGGG
CAAAAGAAAGCAACATTTCTGTGCAAAGATGATGTTTGGAAGACATGTTATAAAGCAATCCATCCTAACTGGCTGCTTGCTTATAGACTAATTGC
TTTCTCCATACTTCTGTCTTTACTCACTGCAGATGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E253141] SGN-U585544 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T68064 [Download][View] Facility Assigned ID: TBFDW13TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0050 Quality Trim Threshold: 14.5