EST details — SGN-E254498

Search information 
Request: 254498Match: SGN-E254498
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C34054Clone name: cLEG-29-I15
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C181481 is on microarray TOM1: SGN-S1-1-2.2.12.1
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C181481 [TUS-37-B7] Trace: SGN-T194229 EST: SGN-E392903 Direction: 3' Facility: INRA
Clone: SGN-C181481 [TUS-37-B7] Trace: SGN-T199257 EST: SGN-E397931 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E254498Length: 389 bp (1013 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E254498 [] (trimmed) GAGTTGCATTCTTCATTCTTGGTTGTGGCCATTCACAAAAAGAATGGGGAATGGGTTGCTTCCTCAAATAATTACACAATGTTTTTTCCCCTGAT
ATCCCAGAACAAATTAAAGAATAGAAAAGAAAACCAAGATAATATTACAGACGACATTCGTAGATTTGAACCTTTAAAACCTTGAACGTTTGCAT
TCAGGAGAAAGGCCTTGAGAGAACCTTTTAGCATCTGCACAGTAATTGGAGATCATGTATTTCTGCTGAACCCATCGAAGCCTATTTCTGTCATT
ACCGGTCAGTTCTTGAGTTAGCCATGCCTGATCATTGGTTACTGAATCAGTCTTAGAGCCTCCACAGGACGAAGGTGACGATGCAGCTGACCAAA
CACAAGCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E254498] SGN-U578224 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T68764 [Download][View] Facility Assigned ID: TBFEI56TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0308 Quality Trim Threshold: 14.5