EST details — SGN-E255315

Search information 
Request: 255315Match: SGN-E255315
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C34433Clone name: cLEG-30-O1
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C183593 is on microarray TOM1: SGN-S1-1-2.2.2.21
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183593 [TUS-42-J7] Trace: SGN-T196092 EST: SGN-E394766 Direction: 3' Facility: INRA
Clone: SGN-C183593 [TUS-42-J7] Trace: SGN-T196092 EST: SGN-E399394 Direction: 3' Facility: INRA
Clone: SGN-C183593 [TUS-42-J7] Trace: SGN-T196093 EST: SGN-E394767 Direction: 5' Facility: INRA
Clone: SGN-C183593 [TUS-42-J7] Trace: SGN-T200369 EST: SGN-E399395 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E255315Length: 536 bp (869 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E255315 [] (trimmed) GTTTTGAACCGACTGAGATCTCTCTGTAGAGTCTCTCAACTCAGCGACGTCCGTTTTGATGAACTCAGAGACCCGGTTTCCATTTTCTCCACCTC
ACAAAATCAGGTAACATGGCGATCTTATTCCGAAGCTTCTCAGCCAACTCCGATAAATCCTCCACCACCACCTCCTCCATCCCCTAATACTTCTA
CAACAACTTCAAGTTCTCTCAATGAATTTGAACTTGCCAAATTCTCTGCCATTGCCGAAACCTGGTGGGATGCAGAAGGACCCTTTAAGCCATTA
CATCTGATGAACCCTACAAGACTTGCTTTTATTAGGTCCACTCTTTGTCGGCACTTCAGAAAGGATCCAAATTGCACTAGACCTTTTGAAGGACT
GAAGTTTGTTGATGTTGGTTGTGGAGGCGGAATTTTATCTGAGCCTTTGGCTCGAATGGGAGCTACGGTCACGGGAGTTGATGCTGTGGACAAAA
ATATTAAGATTGCTCGCCTTCATGCGGATTTGGATCCACAAACTTCTTCAATTGAATATCG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E255315] SGN-U564286 Tomato 200607 Build 2 25 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T69041 [Download][View] Facility Assigned ID: TBFEM85THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.981 Expected Error Rate: 0.0059 Quality Trim Threshold: 14.5