EST details — SGN-E255464

Search information 
Request: 255464Match: SGN-E255464
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C34440Clone name: cLEG-30-O17
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C183595 is on microarray TOM1: SGN-S1-1-8.2.1.4
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183595 [TUS-42-J9] Trace: SGN-T200370 EST: SGN-E399396 Direction: 5' Facility: INRA
Clone: SGN-C183595 [TUS-42-J9] Trace: SGN-T200475 EST: SGN-E399597 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E255464Length: 513 bp (880 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E255464 [] (trimmed) TGCCCTCTTTGGGGCGTTTGTCTGCCGGGCAGCAATTTCCACTGTAGATGTCTTGACTCCTAAAGTCTTTATTGGTCTGCTAGTCGGTGCAATGC
TTCCTTATTGGTTCTCCGCCATGACAATGAAGAGTGTTGGAAGTGCTGCTCTTAAGATGGTTGAGGAAGTGCGTAGGCAATTCAACACCATCCCT
GGTCTCATGGAAGGAACTGCCAAGCCTGACTATGCCACCTGTGTCAAGATCTCCACAGATGCATCGATCAAGGAGATGATTCCACCTGGTGCCCT
CGTCATGCTCACTCCATTGATTGTTGGTATCTTGTTTGGCGTCGAAACACTTTCTGGTGTTCTTGCAGGATCTCTCGTCTCTGGTGTACAGATTG
CCATTTCTGCATCCAACACTGGTGGTGCCTGGGACAACGCTAAGAAGTACATCGAGGCTGGAGCCTCAGAACATGCTAAGACTCTTGGCCCCAAG
GGATCTGATGCACACAAAGCTGCTGTAATTGGTGACAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E255464] SGN-U584601 Tomato 200607 Build 2 104 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T69190 [Download][View] Facility Assigned ID: TBFEM93THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.981 Expected Error Rate: 0.0080 Quality Trim Threshold: 14.5