EST details — SGN-E255479

Search information 
Request: 255479Match: SGN-E255479
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C34283Clone name: cLEG-30-G14
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C177198 is on microarray TOM1: SGN-S1-1-5.3.8.12
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177198 [TUS-25-O20] Trace: SGN-T181788 EST: SGN-E369296 Direction: 3' Facility: INRA
Clone: SGN-C177198 [TUS-25-O20] Trace: SGN-T181789 EST: SGN-E369297 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E255479Length: 534 bp (880 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E255479 [] (trimmed) TTTTTCCAATGAATTGCCTTCAGAATCTTCCCAGATCCTCTGGTTTGCCACTGGGAAGTTTCACAGGCAACTCAAGAAAGCTTTATTCCACTGTT
GTTTCACTGGGGATGACAAAATTTGCTGATCAGCGTCTAAGTATTGTGGCACAAGTTGTATCTGGTCCAGAATCTACTACAGAGAACGATGAGGA
AAAATCCGATACATACAGTCATGACATGACTGCAGCTATGGGAGCTGTCTTGACTTATAGGCATGAGTTATGAATGAACTACAACTTCATCCGTC
CAGATTTGATTGTTGGGTCATGTCTACAGACTCCTGAGGACGTGGACAAGCTTCGGAGCATTGGAGTAAAAACTATATTTTGCTTGCAACAAAAT
CCAGATCTTGAATACTTTGGGGTTGATATCAATGCTATTCGTGAATACGCCAACAAATGTGGTGCTATTGAACACTTGCGTGCCGAAATAAGGGA
TTTTGATGCATTTGATTTGAGGTTGCGGCTTCCAGCTGTAATAAGCATATTGAACAAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E255479] SGN-U578949 Tomato 200607 Build 2 18 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T69205 [Download][View] Facility Assigned ID: TBFEN43TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0149 Quality Trim Threshold: 14.5