Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-C25552

Search information 
Request: 25552Match: SGN-C25552
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C25552Clone name: cLEF-13-E18
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C184215 is on microarray TOM1: SGN-S1-1-4.4.16.1
This clone has been mapped as P18.
Additional sequencing 
Clone: SGN-C184215 [TUS-44-D5] Trace: SGN-T198250 EST: SGN-E396924 Direction: 3' Facility: INRA
Clone: SGN-C184215 [TUS-44-D5] Trace: SGN-T198251 EST: SGN-E396925 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E245160Length: 438 bp (816 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E245160 [] (trimmed) TTCAAGAAAGCTAAAGAACTTACTGTTCTTTGTGACGCTAAGATCTCTCTCATCATGCTATCAAGCACCAGGAAGTATCATGAGTACACAAGCCC
AAACACTACGACAAAAAAGATGATTGATCAGTATCAGAGTGCACTTGGAGTTGATATCTGGAGCATTCACTACGAGAAAATGCAAGAAAACTTGA
AGAGATTGAAAGAGATCAATAACAAGCTAAGAAGAGAGATAAGGCAGAGAACAGGGGAAGACATGAGCGGACTAAATTTGCAGGAACTATGTCAC
TTGCAGGAGAACATCACTGAATCTGTTGCTGAGATTCGTGAACGAAAGTACCACGTGATCAAGAATCAAACAGACACCTGCAAGAAGAAGGCGAG
GAACTTAGAAGAGCAAAATGGAAACCTTGTACTTGACTTGGAAGCAAAATGTGAAGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E245160] SGN-U568929 Tomato 200607 Build 2 29 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T59662 [Download][View] Facility Assigned ID: TMGBX33TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.943 Expected Error Rate: 0.0082 Quality Trim Threshold: 14.5