EST details — SGN-E255899

Search information 
Request: 255899Match: SGN-E255899
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C35469Clone name: cLEG-35-B24
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C180845 is on microarray TOM1: SGN-S1-1-6.3.17.19
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C180845 [TUS-35-G19] Trace: SGN-T187402 EST: SGN-E375634 Direction: 3' Facility: INRA
Clone: SGN-C180845 [TUS-35-G19] Trace: SGN-T187403 EST: SGN-E375635 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E255899Length: 501 bp (904 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E255899 [] (trimmed) GTGGGTGAAGGCAGGTCCATTTATAACAATATGAAGGCTTTCATCAGGTACATGATTTCCTCCAACATTGGTGAGGTCGCCTCTATTTTCCTTAC
TGCTGCCCTAGGCATTCCTGAAGGTCTTATTCCAGTTCAGCTTCTGTGGGTCAACCTGGTCACTGATGGACCACCTGCTACAGCATTGGGATTTA
ATCCACCGGATAAAGATATAATGAAGAAACAACCAAGGAGAAGTGATGATTCATTGATCAGTGCATGGATTTTATTTCGCTATCTGGTAATTGGG
TTGTATGTTGGTGTAGCAACTGTGGGTATTTTTATCATCTGGTTCACTCATGACTCCTTCCTTGGCATTGATTTAAGTAAAGATGGGCACAGTCT
TGTCACCTATTCCCAGCTTGCTAATTGGGGTCAGTGCAAAACCTGGAACAATTTCACCGCGTCACCTTTCACTGCCGGATCAGAAGTGATCAGGT
TTGATAACCCGTGCGATTACTTTGTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E255899] SGN-U581856 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T70383 [Download][View] Facility Assigned ID: TBFFJ12TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0065 Quality Trim Threshold: 14.5