EST details — SGN-E258967

Search information 
Request: 258967Match: SGN-E258967
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C37411Clone name: cLEG-41-P23
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C177419 is on microarray TOM1: SGN-S1-1-8.1.7.18
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177419 [TUS-26-I1] Trace: SGN-T182283 EST: SGN-E368873 Direction: 3' Facility: INRA
Clone: SGN-C177419 [TUS-26-I1] Trace: SGN-T182284 EST: SGN-E368874 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E258967Length: 398 bp (935 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E258967 [] (trimmed) GCCACACCCATACCAGGGGCATTTAACACCAATGCTACAGCTTGGTAGTATCCTTCATTCACAAGGCTTTTCTGTTATAGTTGCACATACTCAAT
ACAATACTCCTAATTATTCCAATCATCCACAATTCGTCTTCCATTCTATGGATGACGGATTACAGGGAATCGACATGTCATTCCCGAGTTTAGAA
AACATATATGATATGAACGAAAACTGCAAGGCGCCTCTCAGAAACTACCTTGTTAGTATGATGGAAGAGGAAGGTGATCAGCTTGCTTGTATCGT
TTATGACAACGTCATGTTCTTTGTCGATGATGTAGCGACTCAGTTGAAGCTTCCCAGCATTGTCCTGCGCACTTTCAGCGCTGCGTATTTGCACT
CTATGATCACCATTTTAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E258967] SGN-U584032 Tomato 200607 Build 2 77 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T71999 [Download][View] Facility Assigned ID: TBFGG96TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0100 Quality Trim Threshold: 14.5