EST details — SGN-E258991

Search information 
Request: 258991Match: SGN-E258991
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C37359Clone name: cLEG-41-N12
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C177397 is on microarray TOM1: SGN-S1-1-6.4.7.17
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177397 [TUS-26-H3] Trace: SGN-T182565 EST: SGN-E369951 Direction: 3' Facility: INRA
Clone: SGN-C177397 [TUS-26-H3] Trace: SGN-T182566 EST: SGN-E369952 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E258991Length: 450 bp (864 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E258991 [] (trimmed) GCTGCAGGAAATTGTAGACACAAGGCCTTACACTAATTTGCTGTCCCAATATGTCACCGCCAATTTTCGTGGCAATGTGGATGTGACTAACTTGC
CAAGGAAGTGGAATGTATGTGTAATAGGGTCACATGATCTTTATGAGCATCCGCATATCAATGATCTTGCGTATATGCCTGCAACCAAAGATGGA
CGATTTGGATTCAACCTGCTTGTGGGTGGATTCTTCAGTCCGAAGCGATGTGCAGAGGCAATTCCTCTTGATGCATGGGTTCCAGCTGATGATGT
AGTCCCTGTTTGCAAAGCTATATTAGAAGCTTATAGAGATCTTGGTACCCGAGGGAACAGGCAGAAAACAAGAATGATGTGGTTAATTGACGAAC
TGGGTGTTGAAGGATTCANGGCAGAAGTTGTGAAGAGAATGCCCCAAAAGAAGCTAGATAGAGAATCTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E258991] SGN-U585549 Tomato 200607 Build 2 37 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T72023 [Download][View] Facility Assigned ID: TBFGH78TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0013 Quality Trim Threshold: 20.5