EST details — SGN-E258993

Search information 
Request: 258993Match: SGN-E258993
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C37362Clone name: cLEG-41-N16
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C177399 is on microarray TOM1: SGN-S1-1-4.4.7.17
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177399 [TUS-26-H5] Trace: SGN-T182487 EST: SGN-E369873 Direction: 3' Facility: INRA
Clone: SGN-C177399 [TUS-26-H5] Trace: SGN-T182488 EST: SGN-E369874 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E258993Length: 392 bp (816 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E258993 [] (trimmed) GGAGAGCCAAAAGAAGGAGTTTAGTGTAGAAATATGGGCGGTTGGGCTATAGCGGTGCACGGTGGCGCTGGTGTGGACCCAAATCTCCCAGATGA
ACGTCAACAACAAGCTAAGCAACTCCTTACTCGTTGCCTTAACATTGGAATCTCCGCTCTTCGCTCTTCTCTACCTGCCATTGATGTCGTTGAAC
TCGTTGTGAGAGAACTTGAAAGTGATCCTCTATTCAATTCGGGTCGTGGATCTGCATTAACTGCAAATAGAACAGTGGAAATGGAGGCGAGCATT
ATGGACGGCGATGGTAGACGATGCGGCGCCGTTTCTGGTATCTCCACCGTGAAAAACCCAATTTCTCTCGCTCGCCTTGTCATGGATAAATCCCC
TCATTCTTACCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E258993] SGN-U583152 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T72025 [Download][View] Facility Assigned ID: TBFGH80TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.986 Expected Error Rate: 0.0099 Quality Trim Threshold: 14.5