EST details — SGN-E259111

Search information 
Request: 259111Match: SGN-E259111
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C37360Clone name: cLEG-41-N13
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C177398 is on microarray TOM1: SGN-S1-1-5.4.7.17
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177398 [TUS-26-H4] Trace: SGN-T182647 EST: SGN-E370033 Direction: 3' Facility: INRA
Clone: SGN-C177398 [TUS-26-H4] Trace: SGN-T182648 EST: SGN-E370034 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E259111Length: 300 bp (915 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E259111 [] (trimmed) GTCAATTTCCTCAGACCTGCTAAGAATCTTAAGAAATATGGGTCATGGGCACTTGTTACTGGACCTACAGATGGTATTGGGAAGGGCTTTGCTTT
TGAATTAGCTCGAAAAGGGCTTAATCTAGTTCTTGTGGGTCGTAACCCTGATAAACTTAAGGATGTTTCTGAATCGATTAAAGCTAAATATGGAC
AGACCCAGATCAAAACAGTCGTCGTTGATTTCTCTGGTGATTTGGATGAAGGGGTTAAGAAGATTAAGGAGACAATTGAAGGATTGGATATTGGG
GTTTTGATTAATAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E259111] SGN-U579116 Tomato 200607 Build 2 46 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T72143 [Download][View] Facility Assigned ID: TBFGG79TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0045 Quality Trim Threshold: 14.5