EST details — SGN-E259162

Search information 
Request: 259162Match: SGN-E259162
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C37408Clone name: cLEG-41-P20
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C177418 is on microarray TOM1: SGN-S1-1-1.4.6.4
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177418 [TUS-26-H24] Trace: SGN-T182724 EST: SGN-E370110 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E259162Length: 389 bp (862 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E259162 [] (trimmed) CGACAATGGTTCTCCCTCGGAAACAATTGAAGTACCAATGAACAGCTGCACTATCCAATTTGGTTGTGAAGGTCAATCAACAGAGTGCATAGATC
CAGTGGGGAATTCCAGCATGGAGCTGACATTTCATCTTTGTTTAACTGATGAACGGGGTACTAACTGCAGGCCCGTTGCAAAAGATACGGTGATT
GAACCAGTTAGAATGCAAAAGGTTATATTGGATTGGACTGAGAAGGAATATGAGCTATATGATGCGAGCTACCTCAAAGACCTTCCAGAGGTTCA
CAAAAGTGGACTTACAGTGAAGAAAACCAAGCAAGAAGCTATATCCTTATTTTCGTGTTTGGAGGCCTTCCTAAAGGAGGAACCTTTANGACCAG
ATGATATGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E259162] SGN-U562940 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T72194 [Download][View] Facility Assigned ID: TBFGH94TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0185 Quality Trim Threshold: 14.5