EST details — SGN-E259647
| Search information |
| Request: 259647 | Match: SGN-E259647 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C37474 | Clone name: cLEG-42-C4 |
| ||
| Library Name: cLEG | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: fruit pericarp
Development Stage: breaker fruit
Microarray: Alias clone SGN-C177453 is on microarray TOM1: SGN-S1-1-6.2.6.1
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C177453 [TUS-26-J11] | Trace: SGN-T182501 | EST: SGN-E369887 | Direction: 3' | Facility: INRA |
| Clone: SGN-C177453 [TUS-26-J11] | Trace: SGN-T182502 | EST: SGN-E369888 | Direction: 5' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E259647 | Length: 177 bp (930 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E259647 [] (trimmed)
ATAGCTCCAACAGGCAGTAGCAGCAACTCCAGTGAGCTCAATATCAACAGCAGCAGCAACTGCTCAAAACAGGTCCGGCCGATCGAGCTCCGGCG
AAGTCCAAAATTTTGGATCGGTGGAAGACGGATCTGTCTCCGAGTTTTGAAATGGAGGATACACCTAAAGCAGAAGATCAGT
AAGTCCAAAATTTTGGATCGGTGGAAGACGGATCTGTCTCCGAGTTTTGAAATGGAGGATACACCTAAAGCAGAAGATCAGT
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E259647] | SGN-U584736 | Tomato 200607 | Build 2 | 31 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T72408 [Download][View] | Facility Assigned ID: TBFGJ14TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.963 | Expected Error Rate: 0.0429 | Quality Trim Threshold: 14.5 |
Working
