EST details — SGN-C2605

Search information 
Request: 2605Match: SGN-C2605
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C2605Clone name: cLEC-16-I8
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173455 is on microarray TOM1: SGN-S1-1-4.3.18.15
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E204977Length: 387 bp (900 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E204977 [] (trimmed) AGCAGCTAGAGAATTCAAAGTGAAGGATCAAGGGGCAATCTACAATCACACTCTTGCCACCATATTGGTGGAATATGCTGCATCGGTCTATGTGT
CAGATTTGACTGAACTATCTACTTGGACATGCCCAAAATGTTATGATTCGACAAAGGGGTCTCAAATTTTAGAGCTCATTGTTGATGTGAAGCGA
TGTCTACAGGCATTTGTGGGGGTGGCTCCAAATCTTAATGCCATTGTAATTGCTTTCCGAGGCACTCAGGGAACTAGCATACAGAATTGGATAGC
AGATCTATACTGGAAGCAGCTTGATATAGAATATCCTGGAATGGAAGATGCAATGGTACATCATGGATTTTATTCTGCTTACCACAACACAACAT
TACGCCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E204977] SGN-U582714 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T26866 [Download][View] Facility Assigned ID: TCACJ52TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.932 Expected Error Rate: 0.0092 Quality Trim Threshold: 20.5