EST details — SGN-C26461

Search information 
Request: 26461Match: SGN-C26461
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C26461Clone name: cLEF-40-H5
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C176327 is on microarray TOM1: SGN-S1-1-4.3.10.1
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176327 [TUS-23-K13] Trace: SGN-T181078 EST: SGN-E369504 Direction: 3' Facility: INRA
Clone: SGN-C176327 [TUS-23-K13] Trace: SGN-T181079 EST: SGN-E369505 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E246163Length: 501 bp (881 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E246163 [] (trimmed) CCGATCCTGACTATCGAGGATATGATCTCCGCCACTTCTGCCCCGTTTGCCAACTCTGATTTTAACCGTTCGATTATCCAGCGTGGCGTTGATTT
GGCTGACCTGGCATGTCTACCCGTCGCTGCTGGTTGGTATGGAAAAATCGAGGAGAAACGAAGAGTGATTAAAGTACAGTCTTTTACATTGAAGG
ACACTATCAATTTCTATATGAGACCGATTGAAGGATTAACCGTACTTCTTGATTTAGACACTCAACAAGTTATTGAAATTTTCGATGAAGGAGAG
AGTATACCAATACCAAAGGCCGCCAACACAGACTATCGCTACTCTCGTATTAAAAAAAACAAACAAAAAATAAACTTACTCAAACCAATATCAAT
CGAACAACCAAATGGTCCAAGTTTCACTATAGAAAACAATCATCTAGTTAAATGGGCAAATTGGGAATTTCACCTGAAGCCGGATCCGAGAGCCG
GGGTGATTATATCCCGGGTCATGTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E246163] SGN-U565031 Tomato 200607 Build 2 20 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T60015 [Download][View] Facility Assigned ID: TMGGC39TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0043 Quality Trim Threshold: 14.5