EST details — SGN-C26625

Search information 
Request: 26625Match: SGN-C26625
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C26625Clone name: cLEF-41-B18
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C176381 is on microarray TOM1: SGN-S1-1-6.1.10.6
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176381 [TUS-23-M19] Trace: SGN-T181013 EST: SGN-E369439 Direction: 3' Facility: INRA
Clone: SGN-C176381 [TUS-23-M19] Trace: SGN-T181014 EST: SGN-E369440 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E247082Length: 378 bp (899 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E247082 [] (trimmed) CCAAGATTGAGAGGGAACCTTCTTGTCGACCAATCTCAAATCTGGAATTTGAATTTGAGAGACGAAGGGTAACAAAGGAGGACATTAAGGAATTA
ATTTTTCGGGAGATATTGGAATATCATCCTCAACTTCAAAAGGATTACATTGCTGGAAATGATGGCACAAATTTTCTCTATCCTAGTGCAACTGA
TCAGTTTAGAAGGCAATTTGCTTATCTTGAGGAAAATAATGATAAAAGTGGGCCAGTTATTCCTCTTGGTAGAAAGCACGTTTCTCTTCCACGAT
CTGCGGTCAATTCCAGTACTGATCCCCCAAAAGCTAGGCAGAACTTCTCTGTGTTTGATCATACGCAAGTAACAGAAAAATCATCTACTGATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E247082] SGN-U579296 Tomato 200607 Build 2 28 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T60497 [Download][View] Facility Assigned ID: TMGGH09TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0217 Quality Trim Threshold: 14.5