EST details — SGN-E266886

Search information 
Request: 266886Match: SGN-E266886
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C49167Clone name: cLEI-7-E9
cartOrder Clone
Library Name: cLEIOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: whole seedlings
Development Stage: germinating seed

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C188928 [TUS-56-H14] Trace: SGN-T338596 EST: SGN-E537721 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C188928 [TUS-56-H14] Trace: SGN-T338599 EST: SGN-E537724 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E266886Length: 434 bp (850 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E266886 [] (trimmed) AGCACCAAGCAATGGCTGTTGCATTTCAGAACGTCAACTCTGAATCTGGCCTCAAGAAGCTTGACGACTTCCTCCTGACCCGCAGTTACATCAGT
GGGTACCAAGCATCAAAGGATGATATCACTGTGTATTCATATCTAGCAAAACCTCCATCAGCTGAATATGTTAATGCATTGAGGTGGTATAAGCA
CATTGATGCACTTTTGAGAATCTCTGGTGTATCCGGTGTAGGTGCTGGTGTTATTGTAGAGGGGTCTGCACCCATCACTGGGGCTGTTGCAACTC
CCCCTGCTGATGACAGTAAGGCCTCAGCTGCTGACGATGATGACGACGATGATGACGTTGACCTATTTGGTGAGGAGACTGAAGAGGAAAAGAAA
GCTGCTGAAGAACGCGCTGCAGCATTGAAGGCTTCAAGGAAGAAGAAAGAATCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E266886] SGN-U575408 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T81111 [Download][View] Facility Assigned ID: TGSAY29TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.981 Expected Error Rate: 0.0059 Quality Trim Threshold: 14.5