EST details — SGN-C2682

Search information 
Request: 2682Match: SGN-C2682
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C2682Clone name: cLEC-16-M21
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173484 is on microarray TOM1: SGN-S1-1-7.1.18.8
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C173484 [TUS-16-E2] Trace: SGN-T192933 EST: SGN-E391607 Direction: 3' Facility: INRA
Clone: SGN-C173484 [TUS-16-E2] Trace: SGN-T197821 EST: SGN-E396495 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E205112Length: 468 bp (820 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E205112 [] (trimmed) CAACACTTCATTACACATCAAAGACATGGCCAATTGTTCAAGATTTCTCTTATTGTTATTACCTCTACTTCTTCACATTCATAATGTAAAAAGTG
AGCTCCAATTAAATTACTACACAAAGAGTTGCCCAAGAGCTGAAGATATCATCAAAGAACAAGTGGCAACATTGTACCACAAACATGGGAACACA
GCAGTTTCTTGGATTAGAAATCTTTTTCATGATTGCATGGTTAAGTCATGTGATGCATCACTATATTTGGACACAGCAAATGGGCTAGAATCAGA
AAAAGAATCTCCAAGGAATTTTGGGATGAGGAATTTTAAGTATATTGAGACAATTAAACAAGCACTTGAAAAAGAATGTCCAAATACCGTTTCTT
GTGCAGATATTGTTGCTCTTTCCGCTAGGGATGGTCTTCTTTGGTTAGGAGGGCCAATAAAAATTGAAATGAAAACAGGAAGGAAAGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E205112] SGN-U579987 Tomato 200607 Build 2 35 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T27001 [Download][View] Facility Assigned ID: TCACI83TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.944 Expected Error Rate: 0.0082 Quality Trim Threshold: 14.5