EST details — SGN-E268551

Search information 
Request: 268551Match: SGN-E268551
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C46817Clone name: cLEI-13-M22
cartOrder Clone
Library Name: cLEIOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: whole seedlings
Development Stage: germinating seed

Microarray: Alias clone SGN-C182436 is on microarray TOM1: SGN-S1-1-7.2.8.15
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C182436 [TUS-39-J2] Trace: SGN-T191768 EST: SGN-E390442 Direction: 3' Facility: INRA
Clone: SGN-C182436 [TUS-39-J2] Trace: SGN-T197483 EST: SGN-E396157 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E268551Length: 476 bp (846 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E268551 [] (trimmed) GTTTCCAGCCCTAAATGGAATGAAATGAAGGATTCCAGTCCGAGCAGAAACCAGCAATTAGTACCCCCTGATTGGTGGTTCGAGGATGTCTCTAT
TCTCAGGATTGATCACTTTGTCAGAGTCATTACTGCTATTAAGGTAAAAGGCATGCGACATGAACTGATTGGTGCTGTTCTTATGCACTATGCTA
CTAAATGGATCCCGGGGCTAATTAAAGAAGGATCCGGATCGTTGGATGATTGTAGCAACAGCAGTACTAGTAATGGCAGTAGCAGCAGTAGCTGG
AAAGGAGGTCTTCATATGATAGTGTCAGGATCTAGAGAGGAAGTACCAACTATTCAAGCCAAAGATCAGAGGATGATTATCGAAAGCCTAATTAG
CATAATCCCACAACAGAAGGACAGCGTCTCGTGTAGCTTCCTTCTACGTCTTTTGAGAATGGCAAACCTGCTGAAAGTGGCTCCAGCACTTGTAA
C
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E268551] SGN-U572146 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T82612 [Download][View] Facility Assigned ID: TGSBX83TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0039 Quality Trim Threshold: 14.5