EST details — SGN-E268552

Search information 
Request: 268552Match: SGN-E268552
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C46819Clone name: cLEI-13-M24
cartOrder Clone
Library Name: cLEIOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: whole seedlings
Development Stage: germinating seed

Microarray: Alias clone SGN-C177645 is on microarray TOM1: SGN-S1-1-6.2.6.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177645 [TUS-27-B11] Trace: SGN-T183124 EST: SGN-E370887 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E268552Length: 392 bp (836 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E268552 [] (trimmed) ATTTCGTAAGCAAGCAGTCTGAACATTACTCCCTATGCCAATTCTAATAGCCAAGCATAAAAAATTATTCAAAGGCATCATAAATCACACGCACA
CAACACCAAGCACACAAGTTTTAAGTATCCAAAATGCCGACCAGAATCCACTACATAGGAAAAGACTATCCATTTGGCCAAGCCATAGTCGCAGA
ATGGTGAAAACTCAAATACGTATGTCCAGTTGCACTACTCAGCAACTACATGTACTCCTTATCCCGATTCAGGAGATCCATCTCCATAGGAAACC
AGACCTGCCTTCCCAGGGGGACTCGCCGAGGATGATACTGACTTGCCTCTGCTGACTTGCTTTGGTGATCGAGAGCCCCGACATGATTTCGACTC
TGATCGGCTTCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E268552] SGN-U581272 Tomato 200607 Build 2 23 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T82613 [Download][View] Facility Assigned ID: TGSBX84TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0099 Quality Trim Threshold: 14.5