Notice: Load is currently high due to bots. Some functionality has been turned off.

EST details — SGN-C27052

Search information 
Request: 27052Match: SGN-C27052
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C27052Clone name: cLEF-42-G20
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C176584 is on microarray TOM1: SGN-S1-1-3.2.9.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E247536Length: 438 bp (1024 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E247536 [] (trimmed) GCGAGACCAAGATGACTACTGCGGTCTCCATCGAAGATGTGCGACGTGAAGTGAAGATTTTGAGGGCTCTATCAGGCCACAAACATCTCGTGAAG
TTTCACGATGGTTGTGAGGATGCTAATAATGTGTACATAGCAATGGAATTGTGTGAAGGAGGAGAATTGCTTGACAGAATATTGTCAAGAGGTGG
TAAATATTCACAGGATGATGCCAAACTTATTATTGCTCAAATTCTAAACGTACTTGCATTCTGTCATCTCCAAGGTGTTGTCCACCGTGACCTGA
AGCCTGAGAATTTCCTTTTCACCTACCGAGATGAAGATGCTGATATGAAGCTCATTGATTATGGTCTTTCTGACTTTATAAGACCAGATGAGAGA
CTTAACGATATTGTGGGAAGTGCATACTATGTGGCACCAGAAGTTCTCCACAGATCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E247536] SGN-U601628 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T60580 [Download][View] Facility Assigned ID: TMGGJ46TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0182 Quality Trim Threshold: 14.5