EST details — SGN-E270693

Search information 
Request: 270693Match: SGN-E270693
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C64688Clone name: cLEM-6-O10
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C178183 is on microarray TOM1: SGN-S1-1-4.4.4.10
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178183 [TUS-28-H21] Trace: SGN-T183567 EST: SGN-E371207 Direction: 3' Facility: INRA
Clone: SGN-C178183 [TUS-28-H21] Trace: SGN-T183568 EST: SGN-E371208 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E270693Length: 294 bp (408 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E270693 [] (trimmed) GGTTGTTGCCAATAGACCTCACAAGTGGGGTCTAGAGAGGGTGGGACGAACGCAGACCTTACCCTACTTTGGGAGGTGGAGAGGTTGTCTGATAG
ACCCCACTGGAGGGTAGGGTTAACGCAGACCTTACCCCTACTTTGGAGATGACAGTATGACAATACTAATGGCATTTCAGACACCAGAAGTTGAG
ATCATAGGCTTGACTACAATCTTTGGCAACGTTACCACAAAAGATGCTACACGAAATGCTTTACTTTTGTGTGAAGCTGCAGGATATCCGGATGT
TCCCGTGGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E270693] SGN-U565781 Tomato 200607 Build 2 29 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T84449 [Download][View] Facility Assigned ID: TGFAV89TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0025 Quality Trim Threshold: 14.5