EST details — SGN-C27134

Search information 
Request: 27134Match: SGN-C27134
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C27134Clone name: cLEF-42-K16
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C176626 is on microarray TOM1: SGN-S1-1-1.3.9.19
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176626 [TUS-24-G24] Trace: SGN-T193079 EST: SGN-E391753 Direction: 5' Facility: INRA
Clone: SGN-C176626 [TUS-24-G24] Trace: SGN-T193328 EST: SGN-E392002 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E247723Length: 550 bp (1014 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E247723 [] (trimmed) GTTTTCCACACACCTCTGAGCTCACCGCTTCACCCAACTATATATAGAAACCCAATTCTGTAATCAACAAATGGAAGAGGAGAAAACTATGTTGA
TTGATGTGAATGAGAAAGAGATGAATGTTAATGGTGGAGTAGTAGTAGAGGTGAAAGAAGAACCAGTTATATTTATTAATGATGAAGATGACATT
ATTGGGGATTCAGTACCAAAGCCTTTGGATGGGTTGCGTGATGTAGGTCCACCTCCGTTTTTGAAGAAGACGTTTGAAATGGTGGATGATCCAAA
TACCGACTCTATAATCTCATGGAGTAACAGTCAAAACAGCTTTGTTGTTTGGGATCCTCACAAATTTTCAATTCATCTTCTACCTAAACATTTTA
AGCACAACAACTTCTCTAGCTTTATCCGCCAGCTCAATACCTATCGTTTCAGGAAAATTGATTCAGATAGATGGGAATTTGCAAATGAGGGTTTT
CAGAAAGGGAAAAAGCATTTGCTGATAAATATCAAGAGAAGAAAGCAGTATCCTCAACTANGAGGAGGAGGTGGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E247723] SGN-U568618 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T60767 [Download][View] Facility Assigned ID: TMGGJ68TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0122 Quality Trim Threshold: 14.5