EST details — SGN-E271481

Search information 
Request: 271481Match: SGN-E271481
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C64294Clone name: cLEM-5-L2
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C177941 is on microarray TOM1: SGN-S1-1-6.2.6.18
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177941 [TUS-27-N19] Trace: SGN-T183112 EST: SGN-E370875 Direction: 3' Facility: INRA
Clone: SGN-C177941 [TUS-27-N19] Trace: SGN-T183113 EST: SGN-E370876 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E271481Length: 495 bp (619 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E271481 [] (trimmed) GAGAAGGGTCATACTTTTTAGATGATTCCTAAGTGCTTTTTTAGCATAGACTAGTAGATCCACTTAGTAGTTCAAGTTCTATGCTGACGGCAAGG
TATAAGATGGTCCTCTTGCAACGTGAGGTATGACCTTGTACCATCACGTAGGCTCATCGTAATTGTTGTCGGTTAGAGAATCTCCTTTAGAAACT
ATATTACTTTATTATATAAGTAAAGTTGAGTTTGTTATTGCATTTTCTTTAACGAACTAAGTTGTTTTTACTATTTTATAAAGCTTTTTATACAT
AGCATGTGTACCGTTGCTTTATATTGAGTTGAATATCCATAGTCGAGTATCATATCTTTGAGCTTAGTATTTAATCTCTAAATGAGTATCTCATT
CTTGAGTATGCTGAGTTGAGTAAGTTGAGTATTCTTGAGCATTCCTTGAGTTTCAAGTTTGAGAAGAGGTAAGTATGTATCCATTTTTCTATCAA
GTATCAAGCTTATTTTATGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E271481] SGN-U562668 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T85286 [Download][View] Facility Assigned ID: TGFAT61TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.933 Expected Error Rate: 0.0016 Quality Trim Threshold: 14.5