EST details — SGN-E271484

Search information 
Request: 271484Match: SGN-E271484
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C64304Clone name: cLEM-5-L8
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C177947 is on microarray TOM1: SGN-S1-1-8.3.6.10
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177947 [TUS-27-O1] Trace: SGN-T182900 EST: SGN-E371392 Direction: 3' Facility: INRA
Clone: SGN-C177947 [TUS-27-O1] Trace: SGN-T182901 EST: SGN-E371393 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E271484Length: 513 bp (624 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E271484 [] (trimmed) GGCTAAAGTGGAGAAGGCAGCTAAAACTATTTCAGACATCAGTTTGGAAGTCGACAGGCTGGCTAGACAGGTTTCTGCACTCGAATCTGTAGTTT
CTAAAGGTGGGAAAGTTGTAGAAAAGGATGTGATAAATCTAACAGAGTTGTTGATGAATCAACTGCTTCAATTGGATGGTATTATTGCTGAAGGT
GATATAAAACTGCAGAGAAAAAATCAGGTGAGAAAAGTGCAAAAGTGTGTTGAAACACTAGATGTATTGAAGATAAAAAATTCAATGCCAACAAA
CAATGGAAACCACACTCCGAAAGACCAATCTCCCCCAGCTCGTCCTCATCAAGATTATATGTATTTGAATGAGCAGGCATCATCACCAGTTCAAC
AACATCAAGATAGACATTCCTTTAGAAATTCACCAGTACAAAGCAAACAGCAGCACCAATCGAGGCACTCAACCTCAGGGTCTGTTGTCATAACA
ACACAATGGGAAACATTTGATTCCACTCCAGCGCCATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E271484] SGN-U577796 Tomato 200607 Build 2 30 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T85289 [Download][View] Facility Assigned ID: TGFAT64TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0023 Quality Trim Threshold: 14.5