EST details — SGN-C27181

Search information 
Request: 27181Match: SGN-C27181
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C27181Clone name: cLEF-42-M23
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C176646 is on microarray TOM1: SGN-S1-1-5.4.9.19
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176646 [TUS-24-H20] Trace: SGN-T193453 EST: SGN-E392127 Direction: 3' Facility: INRA
Clone: SGN-C176646 [TUS-24-H20] Trace: SGN-T193454 EST: SGN-E392128 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E247690Length: 491 bp (940 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E247690 [] (trimmed) TCCTCCTCTTAAAAATTCACTCTCCCTCACTCTCAAACACTATACGCCCTTAGGCGGAAACGTTGCTTGTCCACTAGATACAAACGGATATCCTG
AGTTACGTTATGTGACAGGAGATTCTGTGTCTGTTACTTTTTTCGAGACTGATATGAATTTCAATTATCTCATTGGTGACCATCCGCGTAAGGCT
AAGGATTTTTATCACTTTGTTCCTAAGTTAGGGGAACCTAAGGATGCACCGGGGGTCCAACTAGCCCCGCTCTTAGCCATTCAGGTGACACTTTT
TCCGAATCTTGGTGTATCCATTGGTTTCACTAACCATCATGTTGTTGGTGATGGAGCTACTATAGCAGGGTTCATTAAGGCGTGGGCTCTACTCC
ACAAATTCGGTGGACATGAACAATTCTTATCGAATGAGCTAATTCCATTTTATGATAGGTCCGTAGTAAAAGACCCATATGGACAAGGGATGTCC
ATCTGGGGAAGAAATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E247690] SGN-U571458 Tomato 200607 Build 2 25 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T60734 [Download][View] Facility Assigned ID: TMGGI84TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0036 Quality Trim Threshold: 14.5