EST details — SGN-E273652

Search information 
Request: 273652Match: SGN-E273652
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C68486Clone name: cLEN-6-J11
cartOrder Clone
Library Name: cLENOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: red ripe to over-ripe

Microarray: Alias clone SGN-C183612 is on microarray TOM1: SGN-S1-1-7.3.2.21
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183612 [TUS-42-K2] Trace: SGN-T195043 EST: SGN-E393717 Direction: 3' Facility: INRA
Clone: SGN-C183612 [TUS-42-K2] Trace: SGN-T195044 EST: SGN-E393718 Direction: 5' Facility: INRA
Clone: SGN-C183612 [TUS-42-K2] Trace: SGN-T200459 EST: SGN-E399579 Direction: 5' Facility: INRA
Clone: SGN-C183612 [TUS-42-K2] Trace: SGN-T200311 EST: SGN-E399285 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E273652Length: 554 bp (823 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E273652 [] (trimmed) GAAAGTTCTATCCTTGCAGGACGTATAATTTCCCTTTTCTCTTCTTCTCCCCTTAACGTGAGCCGATTCGCTAACCTGCACCATGAGCTTACTTG
ACAAGCTCTGGGACGACACCGTTGCCGGTCCCCGGCCAGATAGTGGCCTCGGGAAGCTCCGGAAGTATTCTACTTTTAGTCAGCGTTCAAATTCC
GGCAAGGAATCAGAAGTTTCAACACCGAGATCCTTTACTGAGGAAGCAAGTGAGGACGCGGTGAAGGTGACGAGAAGTATCATGATCGTAAAGCC
TTCCGGGAGTCAGAATAGAGATTCACCTCCCGTTTCTCCGGCCGGTACTACTCCTCCGGTATCTCCTTTTTCTGGTTCTTCTGGAAGAGAAGCAT
TTCGGTTCCGTCGGCGATCAGCGTCATTTGCATACGAGAATGCCAGTGGGGTTGGACCCAGAAGCCCTCGTCCTCCTTACGACCTGTGAGATATA
GTCGGGTTCTCCTTTTTTGTTTTCCTTCTTGAGGCGGCTGAATGTAGTATAGCTTAGTCGACATTACTCAACATGTTCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E273652] SGN-U582094 Tomato 200607 Build 2 58 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T88348 [Download][View] Facility Assigned ID: TRRAW54TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0074 Quality Trim Threshold: 14.5