EST details — SGN-E274292

Search information 
Request: 274292Match: SGN-E274292
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C66780Clone name: cLEN-15-N16
cartOrder Clone
Library Name: cLENOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: red ripe to over-ripe

Microarray: Alias clone SGN-C181043 is on microarray TOM1: SGN-S1-1-8.4.17.13
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C181043 [TUS-35-P1] Trace: SGN-T196423 EST: SGN-E395097 Direction: 5' Facility: INRA
Clone: SGN-C181043 [TUS-35-P1] Trace: SGN-T197733 EST: SGN-E396407 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E274292Length: 434 bp (995 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E274292 [] (trimmed) CTAAGTGGAATTCAATGAAGTTGGAAAATTTGAAGAGGCCTAAGTTTTATTTGCCTTTGACTATAATATTGATATTGGTATTTTTGGCTATATAT
GGAAGGTCATTTGCAATAATGTGTACTTCAATTGGATGGTATTTGATACCTACAATTAGAGGGGGAGATTCAAGGTCAAGTGTAAGTACAAGAAA
ACCACAAAGGAAGAAGGATTATATGAGAAGATTTAGTGAAAAAAGTGTTGTTAGAGAAGAACCAATTTCACCAACAAGTGTTATGAATGGACCAA
GTGGTAAATATGACCATAGGAAAAGTTGGTCATGATGGGGAAGGAAAAAAATTATCTTGATCCTCTAAATTCTCCCTTCTTTTTATTGAGATCGT
GATGTCTGAGCCAGTTTACGTACACCTTGACTAATTTCAGATGGGAAGAATCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E274292] SGN-U570739 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T90527 [Download][View] Facility Assigned ID: TRRCH80TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.938 Expected Error Rate: 0.0038 Quality Trim Threshold: 14.5