EST details — SGN-E276395

Search information 
Request: 276395Match: SGN-E276395
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C67156Clone name: cLEN-17-K2
cartOrder Clone
Library Name: cLENOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: red ripe to over-ripe

Microarray: Alias clone SGN-C183011 is on microarray TOM1: SGN-S1-1-8.2.3.4
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183011 [TUS-41-B1] Trace: SGN-T195161 EST: SGN-E393835 Direction: 5' Facility: INRA
Clone: SGN-C183011 [TUS-41-B1] Trace: SGN-T199495 EST: SGN-E398169 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E276395Length: 357 bp (926 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E276395 [] (trimmed) TTCCACCAGCTTAGATCAGTCGAGCAACTTGGTTATATCACTGTGCTCATGCAGAGGAGCGACTCTGGTGTTCACGGGGTGCAGTTTATCGTTCA
GTCAACTGCAAAGGATCCCAAATACATTGACACAAGAGTGGAGTTATTTATGAAGATGTTTGAGAGCAAGCTTTATGAGATGACTAGTGATGAAT
TCAAGAATAATGTCAATGCACTTATTGATATGAAGCTTGAGAAACACAAGAATTTACGGGAGGAATCTCGGTTTTACTGGAGGGAGATCTCAGAT
GGGACCCTCAAGTTTGATAGACGAAACCGTGAGATTGTCGCGTTAAAGCAACTGACTCAAAAGGAGCTGACA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E276395] SGN-U576681 Tomato 200607 Build 2 23 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T90816 [Download][View] Facility Assigned ID: TRRCN61TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0133 Quality Trim Threshold: 14.5