EST details — SGN-E277315

Search information 
Request: 277315Match: SGN-E277315
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C58804Clone name: cLEL-3-L24
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C58804 [cLEL-3-L24] Trace: SGN-T21441 EST: SGN-E277201 Direction: 3' Facility: Novartis
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E277315Length: 235 bp (1312 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E277315 [] (trimmed) AAGTGACTTTATGTTAGATTACAGATTCTTCAAGGAAAGCAAATTTATTACAGAATGCATGTTTAAAAGAGAAGATCAAAATCAATGTGGAAAAA
AAACTTTCATTAAGGAAAAAGGGGAGGAAAAGAAGAGGCATACATATGGACAAGACACCTAAAAAGGAAGCAAATAGACCTTGAACAACTTTACT
TAAGGAAAAGTTATATTTACAAACCTATTCAGCGAGAAGGTAAGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E277315] SGN-U568988 Tomato 200607 Build 2 29 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T21442 [Download][View] Facility Assigned ID: tomato030472.x
Submitter: Koni Sequencing Facility: Novartis
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.878 Expected Error Rate: 0.0241 Quality Trim Threshold: 14.5