EST details — SGN-E277472

Search information 
Request: 277472Match: SGN-E277472
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C73102Clone name: cLER-3-E16
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185091 is on microarray TOM1: SGN-S1-1-8.4.11.1
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185091 [TUS-46-H17] Trace: SGN-T199036 EST: SGN-E397710 Direction: 5' Facility: INRA
Clone: SGN-C185091 [TUS-46-H17] Trace: SGN-T200109 EST: SGN-E398783 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E277472Length: 279 bp (792 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E277472 [] (trimmed) TACCACTATAGCTGTGTGCCTTGTCCTGAATTTCGCAAGGGTGCATGCCGACGCGGTGATATGTGCGAATATGCTCATGGGGTGTTTGAGTGCTG
GCTACACCCTGCTCAGTATCGTACCCCTCTGTGCAAGGATGGCACAAGCTGAGCTAGACGAATCTGATTTTTTGCCCATACTACGGAGGAGCTTA
AGCCCTTGTGTGTCTGTACTGGATCTGCAGTCCCATCTCCTCAGTCAGCTGCTTCTGCAGCTAGTGTGATGGACATGGATGCACCGCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E277472] SGN-U566806 Tomato 200607 Build 2 58 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T92360 [Download][View] Facility Assigned ID: TPRAJ32THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0225 Quality Trim Threshold: 14.5