EST details — SGN-E277565

Search information 
Request: 277565Match: SGN-E277565
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C73815Clone name: cLER-6-E2
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C189754 [TUS-58-J24] Trace: SGN-T339933 EST: SGN-E539058 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C189754 [TUS-58-J24] Trace: SGN-T339935 EST: SGN-E539060 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E277565Length: 269 bp (740 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E277565 [] (trimmed) TTTTTTTTTGCAACAACCATGATAGAAGAACAACGTCATGGACCCCCACACGGCATTCTCTTAGCCGTAGTTGTAGTTGCAGTTATCTTAGTCCC
AACAATCCTCGGTGAAAATGGCGAAGCAATTACTGATTTCATCTCCGATCTTCTTACCCCAATAGGTCTTCTCTTACTCCCTATTATCCTCCTAC
TAACTATCCAGTTCCTCTCCTCCGACACTGGCTCATTCATCAACACCATTTTCTCCACCGGCGAACCTAATTCCATTCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E277565] SGN-U573015 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T93295 [Download][View] Facility Assigned ID: TPRAV25TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.951 Expected Error Rate: 0.0049 Quality Trim Threshold: 14.5