EST details — SGN-E277565
| Search information |
| Request: 277565 | Match: SGN-E277565 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C73815 | Clone name: cLER-6-E2 |
| ||
| Library Name: cLER | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: leaf
Development Stage: 4 weeks
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C189754 [TUS-58-J24] | Trace: SGN-T339933 | EST: SGN-E539058 | Direction: 3' | Facility: INRA (MWG) |
| Clone: SGN-C189754 [TUS-58-J24] | Trace: SGN-T339935 | EST: SGN-E539060 | Direction: 5' | Facility: INRA (MWG) |
| Sequence |
| Sequence Id: SGN-E277565 | Length: 269 bp (740 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E277565 [] (trimmed)
TTTTTTTTTGCAACAACCATGATAGAAGAACAACGTCATGGACCCCCACACGGCATTCTCTTAGCCGTAGTTGTAGTTGCAGTTATCTTAGTCCC
AACAATCCTCGGTGAAAATGGCGAAGCAATTACTGATTTCATCTCCGATCTTCTTACCCCAATAGGTCTTCTCTTACTCCCTATTATCCTCCTAC
TAACTATCCAGTTCCTCTCCTCCGACACTGGCTCATTCATCAACACCATTTTCTCCACCGGCGAACCTAATTCCATTCA
AACAATCCTCGGTGAAAATGGCGAAGCAATTACTGATTTCATCTCCGATCTTCTTACCCCAATAGGTCTTCTCTTACTCCCTATTATCCTCCTAC
TAACTATCCAGTTCCTCTCCTCCGACACTGGCTCATTCATCAACACCATTTTCTCCACCGGCGAACCTAATTCCATTCA
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E277565] | SGN-U573015 | Tomato 200607 | Build 2 | 4 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T93295 [Download][View] | Facility Assigned ID: TPRAV25TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.951 | Expected Error Rate: 0.0049 | Quality Trim Threshold: 14.5 |


