EST details — SGN-E279305

Search information 
Request: 279305Match: SGN-E279305
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C59070Clone name: cLEL-4-J11
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C59070 [cLEL-4-J11] Trace: SGN-T16398 EST: SGN-E229492 Direction: 3' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E279305Length: 510 bp (823 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E279305 [] (trimmed) GCGAGGAAGTTCCTTCTAGCTACCGTATTAGCTCTATTATGTTTCTCATGGACAATCGCAGCCTCCGACGGGCCATTTATTGTCGCACACAAGAA
GGCCGCTCTTACTCGACTCAAATCCGACATCGAACGGATTTCCATCTCCATCGACATCTACAACGAAGGATCTGCGACGGCATACGATGTGAGTC
TTTATGATGATAACTGGTCTCAAGATGTATTTGAAATTGTCGCTGGTAACACATCCATGTCGTGGGAAAGGCTGGACGCTGGGGCTTCTCTCTCC
CATTCCTTTGAGTTGGAAGCTAAGAAAAAAACAGTGTTTTATGGGGCACCAGCGGTCATAACATTCCGTATTCCCACTAAGGCTGCTCTACAGGA
GGCATTCTCAACTCCAATCCTCCCTCTTGACATACTAGCTGATAGGCCCCCGGAGAAGAAGTTTGACTGGGCAAAGAAATTGATGGCGAAATATG
GTTCCTTGATTTCTGTGATCTCAATTGTGGTTCTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E279305] SGN-U578636 Tomato 200607 Build 2 52 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T21672 [Download][View] Facility Assigned ID: tomato040354.t3
Submitter: Koni Sequencing Facility: Novartis
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.986 Expected Error Rate: 0.0021 Quality Trim Threshold: 14.5