EST details — SGN-E279702

Search information 
Request: 279702Match: SGN-E279702
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C73644Clone name: cLER-5-J1
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185327 is on microarray TOM1: SGN-S1-1-4.2.9.2
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185327 [TUS-47-B13] Trace: SGN-T192225 EST: SGN-E390899 Direction: 3' Facility: INRA
Clone: SGN-C185327 [TUS-47-B13] Trace: SGN-T192226 EST: SGN-E390900 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E279702Length: 524 bp (867 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E279702 [] (trimmed) CTCCCGTTTTCGCTCTGAGAATCAGCAAAAATGCAGAAGCAAGAAGCAGCCGCAGCTACGGTGGAATCCGTCCAATGCTTCGGGAGGAAGAAGAC
GGCAGTGGCGGTGACTCACTGCAAGCGTGGGCGTGGTTTGATCAAGATTAACGGTGTCCCAATCGAGCTTGTTCAGCCGGAGATCCTCCGGTACA
AGGCCTTTGAACCAATCCTTCTCTTAGGACGTCATCGTTTCGCCGGAGTTGACATGCGTATCCGTGTGAAGGGAGGTGGTCACACTTCTCAGATC
TACGCTATCCGTCAGTCAATTGCAAAGGCACTTGTTGCGTTTTACCAGAAGTTTGTGGATGAGCAGCAGAAGAAGGAGATTAAGGATATTCTCAT
TCGCTATGATAGGACTCTCCTTGTTGCTGATCCTAGGCGTTGTGAGCCTAAGAAGTTTGGTGGTCGTGGTGCTCGTTCTAGGTTCCAGAAATCTT
ACCGTTGATTTCAATCTTCAATACTATGGATTACCATTTACGGTAATTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E279702] SGN-U580874 Tomato 200607 Build 2 54 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T93211 [Download][View] Facility Assigned ID: TPRAS49TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.985 Expected Error Rate: 0.0122 Quality Trim Threshold: 12.5