EST details — SGN-E279790

Search information 
Request: 279790Match: SGN-E279790
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C74190Clone name: cLER-8-C20
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185973 is on microarray TOM1: SGN-S1-1-6.1.7.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185973 [TUS-48-M11] Trace: SGN-T188201 EST: SGN-E376161 Direction: 3' Facility: INRA
Clone: SGN-C185973 [TUS-48-M11] Trace: SGN-T188202 EST: SGN-E376162 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E279790Length: 419 bp (783 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E279790 [] (trimmed) CTCGTGAATCGATTGAGTGATCTACCATGGCTGCCTCAAAGATGATCGTGTTGAAGAGCTCCGACGGCGAGACTTTCGAGGTGGACGAAGCGGTT
GCTTTGGAATCTCAGACGATCAAGCATATGATTGAGGATGATTGCGCCGACACCAGCATACATTTGTCTAATGTTACCAGCATGATCTTGGCTAA
GGTTATTGAGTACTGCGAACGCCATGTTGATGCTTCTAAAACTGAGGATGAGGCCTCTGCAGATGAGCTCAAAACCTTTGATGCTGATGCTGTCA
AAGTTGATCAGGGCACCCTCTTCGATCTGATCCTGGCTGGCAACTACTTGAACATCAAGAGCTTGCTTGATCTCACTTGCCAGACCGTGGCAGAC
ATGATTAAAGGGGAAACACCAGAGGAGATGCGGAAGACC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E279790] SGN-U580638 Tomato 200607 Build 2 85 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T93692 [Download][View] Facility Assigned ID: TPRBD22TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.981 Expected Error Rate: 0.0353 Quality Trim Threshold: 14.5