Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-C28006

Search information 
Request: 28006Match: SGN-C28006
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C28006Clone name: cLEF-46-E19
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C176848 is on microarray TOM1: SGN-S1-1-3.1.8.1
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176848 [TUS-25-A6] Trace: SGN-T181792 EST: SGN-E369300 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E247116Length: 326 bp (429 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E247116 [] (trimmed) CCTTTGTATCTTTGTCGAAGCCTGTTTTTGTTTGTTCTGTGGAGAGTTTTGGGGGTTTGAAGAGATCTAATGAGAAAACTGATAGTGGTTTGGTT
AAGTGTAAGGCTTATGAAGCGGATCGGGCTGAGCCGATGGAAGGACCTGAATCGAAAGCGGAGTTGGCAAGGAAGATGAAGATCGGTGTTTATTT
TGCTACTTGGTGGTTTTTGAATGTGATTTTTAATATTTATAATAAGAAAGTGTTGAATGCTTTTCCATTTCCTTGGTTAACATCAACTTTGTCAC
TTGCTGCTGGTTCACTTATTATGTTGATTTCTTGGACTCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E247116] SGN-U581521 Tomato 200607 Build 2 25 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T61527 [Download][View] Facility Assigned ID: TMGGY34TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.914 Expected Error Rate: 0.0066 Quality Trim Threshold: 14.5