Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E280279

Search information 
Request: 280279Match: SGN-E280279
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C72145Clone name: cLER-1-E5
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178509 is on microarray TOM1: SGN-S1-1-6.2.4.18
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C72145 [cLER-1-E5] Trace: SGN-T91832 EST: SGN-E280278 Direction: 5' Facility: TIGR
Clone: SGN-C178509 [TUS-29-F11] Trace: SGN-T184119 EST: SGN-E371050 Direction: 3' Facility: INRA
Clone: SGN-C178509 [TUS-29-F11] Trace: SGN-T184120 EST: SGN-E371051 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280279Length: 278 bp (819 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E280279 [] (trimmed) AAGCAAAAAACAGCAACATGTAGATTGAAGTATTCCGGTTATACTTTCACTAAAAACAGTAAGAACAAGGTAGAAATTAGAGGCATCAACAAGTT
TTTAAGAGGCAACATAGAGTTATTATGGCTTGTAGTACTTGGTGGGTACAAAAGGCATCTTGGTAACCACCCCATCATAAGACTTTCCTCGAATC
ACAATCTTGACATTAGTCCCTGTCTTGTGGTTACCCGTTTTTACGTATCCCATTGCTATGTTCTTCTTCAGACAAGGGCTGAAACCAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E280279] SGN-U579550 Tomato 200607 Build 2 99 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T91833 [Download][View] Facility Assigned ID: TPRAA27TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0001 Quality Trim Threshold: 12.5