EST details — SGN-E280291

Search information 
Request: 280291Match: SGN-E280291
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C72189Clone name: cLER-1-G7
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178546 is on microarray TOM1: SGN-S1-1-1.3.3.1
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178546 [TUS-29-G24] Trace: SGN-T183919 EST: SGN-E371590 Direction: 3' Facility: INRA
Clone: SGN-C178546 [TUS-29-G24] Trace: SGN-T183920 EST: SGN-E371591 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280291Length: 370 bp (818 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E280291 [] (trimmed) AAATGAAAATTCCCACATGTTATCAATTAGAACTCTACGAGGAAAAATATGTTGGATCAAACATCTATGCCTAAGATATGAACATGTCTCTAAGC
TTGTATACAAATAAAGTACAATACAAAACAAAGGGACTAAAAATAGATAAAAGAAAGGCAGATGCTAAAGGCCATTATATACAGCAACTTCTCAG
CTACCATGTTTTGCATATCCCTTTGTTTCGTCTGCCACCGTCTTCCAAACATTCGCCATCTTTTCCGCATATCCTGCCTGATTGACAACAAATCC
TCTCAACATTCCCAAGAAGTCATCACGTGGGTCCTTCTCAAATCTCGCAAGCTCACTCTTGGTGGTTTCCTTGAGCCGCTCATAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E280291] SGN-U581601 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T91845 [Download][View] Facility Assigned ID: TPRAA40TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.951 Expected Error Rate: 0.0092 Quality Trim Threshold: 14.5