EST details — SGN-E280376

Search information 
Request: 280376Match: SGN-E280376
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C72338Clone name: cLER-1-O10
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178661 is on microarray TOM1: SGN-S1-1-6.4.3.2
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178661 [TUS-29-L19] Trace: SGN-T184152 EST: SGN-E371083 Direction: 3' Facility: INRA
Clone: SGN-C178661 [TUS-29-L19] Trace: SGN-T184153 EST: SGN-E371084 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280376Length: 397 bp (969 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E280376 [] (trimmed) GCTTGACACCCTGGGAGAGGAGTCCTACAAGGATAGCACTTTGATTATGCAACTTCTGCGTGATAACCTCACTTTGTGGACCTCGGATATGCAGG
ATGATGGAACTGATGAGATCAAAGAACCATCAAAAGCTGATAATGAGTAGTAACATCGTGAGTGAAACTTCTTTGCTTAGAATTGACAACCGATG
ATGTAATTTTACTCATTGATCAAAATTGGCTGTTTGTAGTCCTTATCCTGTGATTTGTAATACCTATTACCTAAAGGCGCTGTTTCTTGCCATTT
GTTGTTTTCATCAAAGATTACCTTTTGTCTACGTATTTCTCTTGTATTTGGATGCTCTGATGAAGCTCTCTTATTTCGTGGAAATGAATATTTAT
TTTCACGAANAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E280376] SGN-U579480 Tomato 200607 Build 2 126 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T91930 [Download][View] Facility Assigned ID: TPRAB89TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.949 Expected Error Rate: 0.0047 Quality Trim Threshold: 12.5