EST details — SGN-E280412
| Search information |
| Request: 280412 | Match: SGN-E280412 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C72364 | Clone name: cLER-1-P13 |
| ||
| Library Name: cLER | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: leaf
Development Stage: 4 weeks
Microarray: Alias clone SGN-C178683 is on microarray TOM1: SGN-S1-1-8.1.3.3
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C178683 [TUS-29-M17] | Trace: SGN-T183801 | EST: SGN-E370460 | Direction: 3' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E280412 | Length: 232 bp (753 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E280412 [] (trimmed)
TGGCTTTCATGACAATGACAACCTCCTTGGCCGGCGGTTCGATCGCGGCCCTGACCAAAGCCCCGGCCGCGACCCGTGGTGCTAGGGTTGTTATG
GTGAAAGCAAGTTCTCACGTGTCTGAGGGAGAAAATGTTGTAATGAGCCACAAGAAGGAGATCAACAACAACAACGGTGGTCGTAGGGAGTTGTT
CTTTGCCATGGCGGACGCTGCCGCATGTTCTGTGGCTGGGGC
GTGAAAGCAAGTTCTCACGTGTCTGAGGGAGAAAATGTTGTAATGAGCCACAAGAAGGAGATCAACAACAACAACGGTGGTCGTAGGGAGTTGTT
CTTTGCCATGGCGGACGCTGCCGCATGTTCTGTGGCTGGGGC
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E280412] | SGN-U577606 | Tomato 200607 | Build 2 | 158 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T91966 [Download][View] | Facility Assigned ID: TPRAC91TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.975 | Expected Error Rate: 0.0279 | Quality Trim Threshold: 12.5 |
Working
