EST details — SGN-E280430

Search information 
Request: 280430Match: SGN-E280430
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C72161Clone name: cLER-1-F22
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178523 is on microarray TOM1: SGN-S1-1-8.3.4.14
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178523 [TUS-29-G1] Trace: SGN-T183834 EST: SGN-E370493 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280430Length: 395 bp (803 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E280430 [] (trimmed) GTTTTCATATATAAAACCACAACCCATACTTAAAACATAGGTAACACAAAACACATATCAAAATGGCAAATGTTACTCGTGATGATGAGCCACCA
CATTTTGTGTTACTTCCTTTTATGGCACAAGGCCATACAATCCCTATAATAGACATAGCTCGTTTGTTAGCACAAAGAGGTGTTATTGTCACAAT
ACTTATGACACCTTTAAATGCCACAAGGTTCAATAATGTCATAGCCCGCGCAGTCGAAAAAGGACTCAATATTCATATAATTCACCTCAAGTTTC
CAAGTTTAGAGGCAGGGTTACCACAAGATTGTGAAAATTGTGACATGATTTTATCAATGGACATGATAAAGAAGTTCTTTAATGCTACTCAAATG
CTTGAGACACAAGTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E280430] SGN-U580322 Tomato 200607 Build 2 38 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T91984 [Download][View] Facility Assigned ID: TPRAD35TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0047 Quality Trim Threshold: 14.5