EST details — SGN-E280452
| Search information |
| Request: 280452 | Match: SGN-E280452 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C72335 | Clone name: cLER-1-N8 |
| ||
| Library Name: cLER | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: leaf
Development Stage: 4 weeks
Microarray: Alias clone SGN-C178658 is on microarray TOM1: SGN-S1-1-1.4.4.19
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C178658 [TUS-29-L16] | Trace: SGN-T1505 | EST: SGN-E378178 | Direction: 5' | Facility: Giov. Lab |
| Clone: SGN-C178658 [TUS-29-L16] | Trace: SGN-T184291 | EST: SGN-E371524 | Direction: 3' | Facility: INRA |
| Clone: SGN-C178658 [TUS-29-L16] | Trace: SGN-T184292 | EST: SGN-E371525 | Direction: 5' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E280452 | Length: 239 bp (842 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E280452 [] (trimmed)
AACGGGAGAGAATAGAGCAAATTCTCTCTCTGTTTTCACTACAAAAAATCTTTGATTTCAATTTGAGAGAGATCGGAAATGGCTTCTTCCAAAGA
ACGCGAGAACTTCGCCTACGTCGCTAACCTCGATGCTACTGCCGAACGCTACGATGAAATGGTTGAAGCGATGAAAAATGTCGCAAACATGGATG
TTGAATTGACTGAGGAGGAAAGGAATCTTCTTTCTGATGGATATAACGA
ACGCGAGAACTTCGCCTACGTCGCTAACCTCGATGCTACTGCCGAACGCTACGATGAAATGGTTGAAGCGATGAAAAATGTCGCAAACATGGATG
TTGAATTGACTGAGGAGGAAAGGAATCTTCTTTCTGATGGATATAACGA
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E280452] | SGN-U578295 | Tomato 200607 | Build 2 | 99 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T92006 [Download][View] | Facility Assigned ID: TPRAD76TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.961 | Expected Error Rate: 0.0335 | Quality Trim Threshold: 14.5 |


