Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E280485

Search information 
Request: 280485Match: SGN-E280485
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C72134Clone name: cLER-1-E15
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178498 is on microarray TOM1: SGN-S1-1-1.1.3.1
See unigene SGN-U578975 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C72134 [cLER-1-E15] Trace: SGN-T92038 EST: SGN-E280484 Direction: 5' Facility: TIGR
Clone: SGN-C178498 [TUS-29-E24] Trace: SGN-T1494 EST: SGN-E378393 Direction: 5' Facility: Giov. Lab
Clone: SGN-C178498 [TUS-29-E24] Trace: SGN-T183981 EST: SGN-E371652 Direction: 3' Facility: INRA
Clone: SGN-C178498 [TUS-29-E24] Trace: SGN-T183982 EST: SGN-E371653 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280485Length: 321 bp (811 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E280485 [] (trimmed) AGGCTTCTCCTTGAAGTGTCAAATTAATGTTACATTTTTTTACAAGATGAAGATTTAATATAATATACGTAAAAACCATCCTCATGCATGTTGCT
TAATTAAGAGAAGAATCCGAAGGTGTCGAAAATGGTAGTGTGAAGCGGGTCACTCAAGTGGGTAGCCCAGTTGTTAAGTGGGCCTTTTCCAGTAG
CAGCAGCTTGGACAGCAAAGCCCAAGAACGCAACCATGGCGAGCCGAGCATGCTTGATCTCAGCGAGTTGAAGGGTGGCTTTTTTCTCCGGGTCA
GCAGCAAGGCCCAATGGATCGAAGAATGATCCACCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E280485] SGN-U578975 Tomato 200607 Build 2 245 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T92039 [Download][View] Facility Assigned ID: TPRAA32TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0126 Quality Trim Threshold: 14.5