EST details — SGN-E280606

Search information 
Request: 280606Match: SGN-E280606
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C72248Clone name: cLER-1-J5
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178589 is on microarray TOM1: SGN-S1-1-6.1.3.2
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178589 [TUS-29-I19] Trace: SGN-T183784 EST: SGN-E370443 Direction: 3' Facility: INRA
Clone: SGN-C178589 [TUS-29-I19] Trace: SGN-T183785 EST: SGN-E370444 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280606Length: 439 bp (722 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E280606 [] (trimmed) TTATGTTCTCATCCTCCTCAAAAGGTTTGAAAACAAACGCTAATTTTGAGAATCCATATGTTTCGTTCCGTTTTCAAATCGTTTCTAAATCTTCC
TAAATCTATCTCCATATTAACACCTTCTGTTTATCGCCCAATTTCGATCTCCATTTCTAGCTCATACTCAACTCCAAGAATTAGCAAGAGAATTG
GGTCATTGTTTTCTGTACCCGTTGGTGAGCAATTTCAAGAATTTGGGTCGTTATTTTCAGCTAAATACAGCACCAATGGAGACGGATGTGTTGAT
ACGGGGATTGGTGGTAGAGACTACTTGTTGATGTCGGATGAGGAGTTGATGAAACAGTGTGAATTGAGCACTTTCAAGGCTTCAGGTCCTGGTGG
ACAGCACCGTAACAAGCGTGAATCAGCTGTGCGTTTGAAGCATAGCCCAACAGGGATTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E280606] SGN-U569444 Tomato 200607 Build 2 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T92160 [Download][View] Facility Assigned ID: TPRAC51TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0098 Quality Trim Threshold: 14.5