EST details — SGN-C28087

Search information 
Request: 28087Match: SGN-C28087
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C28087Clone name: cLEF-46-I17
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C176880 is on microarray TOM1: SGN-S1-1-3.2.8.5
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E247277Length: 325 bp (425 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E247277 [] (trimmed) GAATTAGCATCTTCCTAGACGCAAAACGCAAAAGGTAGCAGAAGGAAAGTAGCAAAGCAAAGCTTTTTTAAGCTTATAGATCCACCCCAAGATCA
AAAACTATCGCAAAATTGATCTTTTTGTTCTTGGGAGATGAGGCATTGTAGAAATTTTCTTGGGGTTTTATCCTTATAGATTTAGGGGTGTTTAA
TTTTTATCTTCAATTGAGAAATCTGGCTAATTTAGGAGGATTAAGGCCGCGCTTGTCATTGAAACAAGCAACTCCTGACGACCAAGACGAAGAGG
AGTGTAGGCCTTGGCGTAAGAGGTTATCAATGGCTTTTCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E247277] SGN-U572103 Tomato 200607 Build 2 22 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T61688 [Download][View] Facility Assigned ID: TMGGY57TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.948 Expected Error Rate: 0.0032 Quality Trim Threshold: 14.5