EST details — SGN-E282587

Search information 
Request: 282587Match: SGN-E282587
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C70520Clone name: cLER-15-C1
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185143 is on microarray TOM1: SGN-S1-1-4.2.11.2
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185143 [TUS-46-J21] Trace: SGN-T1874 EST: SGN-E378644 Direction: 5' Facility: Giov. Lab
Clone: SGN-C185143 [TUS-46-J21] Trace: SGN-T199047 EST: SGN-E397721 Direction: 5' Facility: INRA
Clone: SGN-C185143 [TUS-46-J21] Trace: SGN-T199104 EST: SGN-E397778 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E282587Length: 535 bp (784 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E282587 [] (trimmed) GGACGCTATTGGACCTGCGGCTCCCGGGGGCTGCAGGGTATTTGGTGCCCTAAATCAAAATTCAAAAAAATTCTATTCATCGGTTCACTTTGGTC
ACCCTCACCGCGCAGCTACCGTCGGCGACCAACAGAACAGCGGCGCAGCCACCGTCGGCGACCATCAGGGCAGCGGCGTAGAAACCGTCGGCAAC
CAGAAGGGCAGCGGAGCTGTTTTGGCTGCCATTTTCAAGTGCTCTTATTGAATATATACCATCATTATGGATGCTCCGAATGAACTGAGCTACAA
ACCACCATCAGAATTTGAGGAGGTCAGAAAGGATTCACTTGTCAATCTTAACATTTCAGACTCAACTGAGCTCTGGCTTATACAGTGGCCCTTTA
ATCAACATCCAGGTCTTGATGGGCAAGAAGTTTCATTGAAGCTCCATCATGATGGGCATATCGGCAGTTTTGAGGATTCATCTGGTAAATCATAT
GAGGCGGTCAGTTGTAGAGCGCACGACCCCGATGCGTTGGTCTTTCTATCATCTGATTCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E282587] SGN-U571864 Tomato 200607 Build 2 30 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T95107 [Download][View] Facility Assigned ID: TPRCE13THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.981 Expected Error Rate: 0.0103 Quality Trim Threshold: 14.5